View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17271_low_9 (Length: 266)

Name: NF17271_low_9
Description: NF17271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17271_low_9
NF17271_low_9
[»] chr1 (1 HSPs)
chr1 (7-207)||(31641676-31641876)


Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 7 - 207
Target Start/End: Original strand, 31641676 - 31641876
Alignment:
Q  7 ggaggagcagagaggttggtgtgaaaatttggagattcaggcttgatgttgtggtggagagtattattaaggttgctagggttagggttttgttgaggtg 106  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  31641676 ggaggagaagagaggttggtgtgaaaatttggagattcaggcttgatgttgtggtggagagtattattaaggttgctagggttagggttttgttgaggtg 31641775  T
Q  107 ggtcccaggtgatgtggctttgtgggttttggaaactttgttgttgatttgggaagaggaaaagagattggactaatgggtttgtgtttgtggtgatgat 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
T  31641776 ggtcccaggtgatgtggctttgtgggttttggaaactttgttgttgatttgggaagaggaaaagagattggactaatgggtttgtgtttgtggtggtgat 31641875  T
Q  207 g 207  Q
    |    
T  31641876 g 31641876  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University