View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17270_high_5 (Length: 240)

Name: NF17270_high_5
Description: NF17270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17270_high_5
NF17270_high_5
[»] chr2 (1 HSPs)
chr2 (19-240)||(35329168-35329389)


Alignment Details
Target: chr2 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 19 - 240
Target Start/End: Complemental strand, 35329389 - 35329168
Alignment:
Q  19 ccctggccctgcgcaatatccagttgacgcaaatgtgtaatgtataatcagcatttaaattaaggattaacaccagacttaggacttagatttgtgtgct 118  Q
    |||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
T  35329389 ccctggccctgcccaatatccagttgatgcaaatgtgtaatgtataatcagcatttaaattaaggattaacaccagacttgggacttagatttgtgtgct 35329290  T
Q  119 tggtagtctatggttaatttgtaatcttaaaccttatggtgcccttttgtagcggaaatgtttatggttttaaatggctcatgnnnnnnngggtgtaaat 218  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||| ||||||||||       ||||||||||    
T  35329289 tggtagtctatggttaatttgtaatcttaaaccttatggtgctcttttgtagcggaaatatttatggttttagatggctcatgtttttttgggtgtaaat 35329190  T
Q  219 tgagtaacttccgcgcggaact 240  Q
    ||||||||||||||||||||||    
T  35329189 tgagtaacttccgcgcggaact 35329168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University