View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1726_low_24 (Length: 225)

Name: NF1726_low_24
Description: NF1726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1726_low_24
NF1726_low_24
[»] chr7 (1 HSPs)
chr7 (90-206)||(9142648-9142764)


Alignment Details
Target: chr7 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 90 - 206
Target Start/End: Original strand, 9142648 - 9142764
Alignment:
Q  90 cacgttggtcttttagtttatcaacttcatccctttagggaccaatttgcatagatgagacattcataaaccatgacaatgcaagaaacatatcacatga 189  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  9142648 cacgttggtctcttagtttatcaacttcatccctttagggaccaatttgcatagatgagacattcataaaccatgacaatgcaagaaacatatcacatga 9142747  T
Q  190 acccaattatgctttta 206  Q
    |||||||||||||||||    
T  9142748 acccaattatgctttta 9142764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University