View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17268_low_17 (Length: 251)

Name: NF17268_low_17
Description: NF17268
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17268_low_17
NF17268_low_17
[»] chr6 (1 HSPs)
chr6 (86-133)||(1441286-1441333)


Alignment Details
Target: chr6 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 86 - 133
Target Start/End: Original strand, 1441286 - 1441333
Alignment:
Q  86 tatttcatgttattatgtgatgagtccttgcgcttcataagcaagata 133  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
T  1441286 tatttcatgttattatgtgatgagtccttgcgcttcataagcaagata 1441333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University