View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17265_high_64 (Length: 246)

Name: NF17265_high_64
Description: NF17265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17265_high_64
NF17265_high_64
[»] chr8 (2 HSPs)
chr8 (1-242)||(6146056-6146300)
chr8 (7-52)||(6180344-6180389)


Alignment Details
Target: chr8 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 6146056 - 6146300
Alignment:
Q  1 ttttagaaaatgatacaacatgattggatgagatacttacttcaccaaactcattaaaagagtattacctaagagaacatggaagagatgataagagtct 100  Q
    ||||||||||||||||||||||||| |||||||||| | |||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||    
T  6146056 ttttagaaaatgatacaacatgattagatgagatacctgcttcaccaaacttattaaaagagtattacccaagagaacatggaagagatgataagagtct 6146155  T
Q  101 -ttccgacctaaccacatatca---nnnnnnnnnnnnnngaaagaaaggtggtcttaaatctcttaagggagaattttaatgtctattatagtcctattt 196  Q
     |||||||||||||||||||||                 |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
T  6146156 cttccgacctaaccacatatcattttattttatttttttgaaagaaaggtggtcttaaatctcttaagggagaattttaatgtctatgatagtcctattt 6146255  T
Q  197 gactttagaagaattcatcgctgcatttatccatggagaataatct 242  Q
    ||| |||||||||||||||||||||| ||| |||||| ||||||||    
T  6146256 gac-ttagaagaattcatcgctgcatgtatacatggaaaataatct 6146300  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 7 - 52
Target Start/End: Original strand, 6180344 - 6180389
Alignment:
Q  7 aaaatgatacaacatgattggatgagatacttacttcaccaaactc 52  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||    
T  6180344 aaaatgatataacatgattggatgagatacttacttcaccaaactc 6180389  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University