View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17265_high_50 (Length: 293)

Name: NF17265_high_50
Description: NF17265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17265_high_50
NF17265_high_50
[»] chr4 (1 HSPs)
chr4 (19-273)||(7465412-7465666)


Alignment Details
Target: chr4 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 19 - 273
Target Start/End: Original strand, 7465412 - 7465666
Alignment:
Q  19 cctgtgcagtgttgaatgtgagcagaatatgggaatcaagggcggactcagccaaattatggcacgtgcatccannnnnnncagaggtgtttttcaaagt 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||       |||||||||||||||||||    
T  7465412 cctgtgcagtgttgaatgtgagcagaatatgggaatcaagggcggactcaggcaaattatggcacgtgcatccatttttttcagaggtgtttttcaaagt 7465511  T
Q  119 ctgtcagttgctggataatggagttttggcctcattttgcatggttttatggagtctttggaatagaagaaatacaaaagtattggatggcttgcaaaaa 218  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  7465512 ctgtcagttgctggataatggagttttggcctcatttcgcatggttttatggagtctttggaatagaagaaatacaaaagtattggatggcttgcaaaaa 7465611  T
Q  219 gattactctcaggcactggctatggcatataaagtgatgcaatcttggtgtcatg 273  Q
    |||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
T  7465612 gattactctcaggcactggctatggcatatcaagtgatgcaatcttggtgtcatg 7465666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University