View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17264_low_57 (Length: 253)

Name: NF17264_low_57
Description: NF17264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17264_low_57
NF17264_low_57
[»] chr3 (1 HSPs)
chr3 (17-132)||(45006666-45006780)


Alignment Details
Target: chr3 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 17 - 132
Target Start/End: Original strand, 45006666 - 45006780
Alignment:
Q  17 ataaattaatgatctagtcgccataatagtcaggtcaccaaattagttgatcacccatcaactggtaaaggagtattctggtcaatttgttccattcaat 116  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
T  45006666 ataaattaatgatctagtcaccataatagtcaggtcaccaaattagttgatcacccatcaactggtaaaggagaattctggtcaatttgttccattcaat 45006765  T
Q  117 gtacccccacaatacc 132  Q
    ||| ||||||||||||    
T  45006766 gta-ccccacaatacc 45006780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University