View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17264_high_68 (Length: 220)

Name: NF17264_high_68
Description: NF17264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17264_high_68
NF17264_high_68
[»] chr8 (1 HSPs)
chr8 (34-120)||(38947057-38947143)


Alignment Details
Target: chr8 (Bit Score: 58; Significance: 1e-24; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 34 - 120
Target Start/End: Complemental strand, 38947143 - 38947057
Alignment:
Q  34 cagaacctgtgaactaggatatattaaaatttattagcaagnnnnnnngaatatattgaatttcttattttattttactatgaggta 120  Q
    ||||||| ||||||||| |||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||||    
T  38947143 cagaacccgtgaactagaatatattaaaatttattagcaagaaaaaaagaatatattgaatttcttattttattttactatgaggta 38947057  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University