View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17260_low_82 (Length: 247)

Name: NF17260_low_82
Description: NF17260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17260_low_82
NF17260_low_82
[»] chr2 (1 HSPs)
chr2 (6-231)||(36109154-36109369)


Alignment Details
Target: chr2 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 6 - 231
Target Start/End: Original strand, 36109154 - 36109369
Alignment:
Q  6 gaagaatatgagtggtgtttataaactaaatttagtttacaaacaagtccatttagcttgtgttttcgaggcattgtccgttttaggtgtgtatgatacg 105  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
T  36109154 gaagaatatgagtggtgtttataaactaaatttagtttacaaacaagtccatttagcttgtgttttcgaggtattgtccgttttaggtgtgtatgatacg 36109253  T
Q  106 ctttggcttgtgtctcaacttctaaataatgtgggactattttagtttaacggagtactgcccgaacacgcataactatcactcgtttaaggtttgatta 205  Q
    ||||||||||||||||||||||||||||          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  36109254 ctttggcttgtgtctcaacttctaaata----------attttagtttaacggagtactgcccgaacacgcataactatcactcgtttaaggtttgatta 36109343  T
Q  206 atgttgattaattctttattaattca 231  Q
    ||||||||||||||||||||||||||    
T  36109344 atgttgattaattctttattaattca 36109369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University