View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17260_high_85 (Length: 243)

Name: NF17260_high_85
Description: NF17260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17260_high_85
NF17260_high_85
[»] chr5 (1 HSPs)
chr5 (1-166)||(35282618-35282783)
[»] chr3 (1 HSPs)
chr3 (19-68)||(31472625-31472674)


Alignment Details
Target: chr5 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 1 - 166
Target Start/End: Complemental strand, 35282783 - 35282618
Alignment:
Q  1 tgtttgagtagaatttttcttgaacctacttggtttcctagtttggatgctgctaagacttttcttggctattattgggaaaatagtgagaatagtagaa 100  Q
    ||||||||||| ||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||    
T  35282783 tgtttgagtaggatttttcttgaacctacttggtttcctagcttggatgctgccaagacttttcttgggtattattgggaaaatagtgagaatagtagaa 35282684  T
Q  101 atacttggtgattcctatgagattatgttggatattaggatctaaacttagaaacatacatgattg 166  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
T  35282683 atacttggtgattcatatgagattatgttggatattaggatctaaacttagaaacatacatgattg 35282618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 19 - 68
Target Start/End: Complemental strand, 31472674 - 31472625
Alignment:
Q  19 cttgaacctacttggtttcctagtttggatgctgctaagacttttcttgg 68  Q
    ||||||||||| |  |||||||| ||||||||||||||||||||||||||    
T  31472674 cttgaacctacctactttcctagcttggatgctgctaagacttttcttgg 31472625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University