View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17260_high_73 (Length: 256)

Name: NF17260_high_73
Description: NF17260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17260_high_73
NF17260_high_73
[»] chr7 (2 HSPs)
chr7 (21-246)||(35489611-35489832)
chr7 (207-248)||(35503063-35503104)
[»] chr5 (1 HSPs)
chr5 (191-248)||(40160265-40160322)


Alignment Details
Target: chr7 (Bit Score: 176; Significance: 7e-95; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 176; E-Value: 7e-95
Query Start/End: Original strand, 21 - 246
Target Start/End: Complemental strand, 35489832 - 35489611
Alignment:
Q  21 taagaaaaatgccgaagtgtacgaactttgcatgaaaacatggtattaattctttcatgcatatttggtnnnnnnnnngagaaaccgcttgtaatcagca 120  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||          |||||||||||||||||||||    
T  35489832 taagaaaaatgccgaagtgtacgaactttgcatgaaaacatggtattaattctttcatgcatatttggtaaaaa-----agaaaccgcttgtaatcagca 35489738  T
Q  121 acaatgttttt-atatacaaaaagtagatatatttgattgaagaaaaggatataaggtttaactagtgtttaacttacgttctctcatagactgtgcttg 219  Q
    ||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
T  35489737 acaatgttttttatatacaaaaagtagatatatttgattgtagaaaaggatataaggtttaactaatgtttaacttacgttctctcatagactgtgcttg 35489638  T
Q  220 aatcagtgaagtaaataacaccttcat 246  Q
    |||||||||||||||||||||||||||    
T  35489637 aatcagtgaagtaaataacaccttcat 35489611  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 207 - 248
Target Start/End: Complemental strand, 35503104 - 35503063
Alignment:
Q  207 tagactgtgcttgaatcagtgaagtaaataacaccttcatct 248  Q
    ||||||||||||||||||||||||||||| ||| ||||||||    
T  35503104 tagactgtgcttgaatcagtgaagtaaatcacatcttcatct 35503063  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 191 - 248
Target Start/End: Complemental strand, 40160322 - 40160265
Alignment:
Q  191 aacttacgttctctcatagactgtgcttgaatcagtgaagtaaataacaccttcatct 248  Q
    ||||||| |||||| |||||||||||||||||||||||||||||| ||| ||||||||    
T  40160322 aacttaccttctctgatagactgtgcttgaatcagtgaagtaaatcacatcttcatct 40160265  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University