View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1725_low_1 (Length: 632)

Name: NF1725_low_1
Description: NF1725
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1725_low_1
NF1725_low_1
[»] chr3 (1 HSPs)
chr3 (549-588)||(27734090-27734129)


Alignment Details
Target: chr3 (Bit Score: 36; Significance: 0.00000000006; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 549 - 588
Target Start/End: Complemental strand, 27734129 - 27734090
Alignment:
Q  549 catctctttaaagacaacctcatacatatgtatcatgttc 588  Q
    ||||||||||||||||||||||||||||||||| ||||||    
T  27734129 catctctttaaagacaacctcatacatatgtattatgttc 27734090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University