View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17259_high_45 (Length: 260)

Name: NF17259_high_45
Description: NF17259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17259_high_45
NF17259_high_45
[»] chr5 (1 HSPs)
chr5 (1-196)||(6293235-6293430)


Alignment Details
Target: chr5 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 196
Target Start/End: Complemental strand, 6293430 - 6293235
Alignment:
Q  1 taacaagcacactttcttctcacacacaaaaattgtcgtcatcatcatcattgatataccaaatcaaaattgtgcttttggggggttggatatctatgaa 100  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  6293430 taacaagcacacttttttctcacacacaaaaattgtcgtcatcatcatcattgatataccaaatcaaaattgtgcttttggggggttggatatctatgaa 6293331  T
Q  101 atagaataaacgaattgcgaaaaaattgaaagaatttggtgaatttatactctcactgaccttgatgaaaacgaaattcaaaaccctaaattgaag 196  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  6293330 atagaataaacgaattgcgaaaaaattgaaagaatttggtgaatttatactctcactgaccttgatgaaaacgaaattcaaaaccctaaattgaag 6293235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University