View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17257_low_17 (Length: 267)

Name: NF17257_low_17
Description: NF17257
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17257_low_17
NF17257_low_17
[»] chr4 (1 HSPs)
chr4 (19-261)||(36476131-36476380)


Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 19 - 261
Target Start/End: Complemental strand, 36476380 - 36476131
Alignment:
Q  19 ggcttccttcctacacgcgagagattggttatga-------gagggattcaatgtccaatacatcgcaggtctggacagaagctggatgctggaatcagc 111  Q
    ||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  36476380 ggcttccttcctacacgcgagagattggttatgacttatgagagggattcaatgtccaatacatcgcaggtctggacagaagctggatgctggaatcagc 36476281  T
Q  112 ggcagaatattgccggaaatgcatcagatattgcagatttggtatttctcgtgctggaaaatcttcctagtcagaagacgaattaatttgcagcaaccat 211  Q
     ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
T  36476280 tgcagaatattgccggaaatgcatcagatattgcagatttggtatttctcgtgctggaaaatcttcctagtcagaagacgaattgatttgcagcaaccat 36476181  T
Q  212 gtggggaatttggtggaaaataaactgaaaaatttgggagaatgaggatc 261  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
T  36476180 gtggggaatttggtggaaaataaactgaaaaatttgggagaatgaggatc 36476131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University