View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17248_low_56 (Length: 201)

Name: NF17248_low_56
Description: NF17248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17248_low_56
NF17248_low_56
[»] chr2 (1 HSPs)
chr2 (1-37)||(5273639-5273675)


Alignment Details
Target: chr2 (Bit Score: 37; Significance: 0.000000000004; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.000000000004
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 5273675 - 5273639
Alignment:
Q  1 ctggtgcaaaaagggttaagccaccactgctagaatc 37  Q
    |||||||||||||||||||||||||||||||||||||    
T  5273675 ctggtgcaaaaagggttaagccaccactgctagaatc 5273639  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University