View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17248_high_7 (Length: 455)

Name: NF17248_high_7
Description: NF17248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17248_high_7
NF17248_high_7
[»] chr3 (1 HSPs)
chr3 (31-89)||(1459216-1459274)
[»] chr5 (1 HSPs)
chr5 (128-161)||(13713632-13713665)
[»] chr2 (1 HSPs)
chr2 (1-29)||(1052547-1052575)


Alignment Details
Target: chr3 (Bit Score: 51; Significance: 5e-20; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 31 - 89
Target Start/End: Original strand, 1459216 - 1459274
Alignment:
Q  31 acagcaacgcaatatattgcaagaaaaaacatcccgaattgatcccgatgctgctttag 89  Q
    ||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||    
T  1459216 acagcaatgcaatatattgcgagaaaaaacatcccgaattgatcccgatgctgctttag 1459274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 34; Significance: 0.0000000007; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 128 - 161
Target Start/End: Complemental strand, 13713665 - 13713632
Alignment:
Q  128 gtggaaaacatgatggtcaatgtgttgaccagcc 161  Q
    ||||||||||||||||||||||||||||||||||    
T  13713665 gtggaaaacatgatggtcaatgtgttgaccagcc 13713632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 1 - 29
Target Start/End: Original strand, 1052547 - 1052575
Alignment:
Q  1 gttgtacaaatatcatttctcttaataaa 29  Q
    |||||||||||||||||||||||||||||    
T  1052547 gttgtacaaatatcatttctcttaataaa 1052575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University