View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17247_low_10 (Length: 218)

Name: NF17247_low_10
Description: NF17247
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17247_low_10
NF17247_low_10
[»] chr8 (1 HSPs)
chr8 (1-209)||(32804987-32805195)
[»] chr6 (1 HSPs)
chr6 (1-208)||(6095723-6095930)


Alignment Details
Target: chr8 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 209
Target Start/End: Original strand, 32804987 - 32805195
Alignment:
Q  1 aagctagatacttccctcgtaccactttcttggaatcaaagattggatttcaacccagctatgcttggagaagtctgttgtctgcaaaaggggttattga 100  Q
    ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
T  32804987 aagctagatacttccctcgtaccactttcttggaagcaaagattggatttcaacccagctatgcttggagaagtctgttgtctgcaaaagaggttattga 32805086  T
Q  101 aactggtgcaagatgggaaataggggatgggagtcttgtctgcatcttcaaagataggtggatcccttgttccaatggttttcttctcaacattccggga 200  Q
    |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
T  32805087 aactggtgcaagatgggaaataggggatgggagtcttgtccgcatcttcaaagataggtggatcccttgttccaatggttttcttctcaacaatccggga 32805186  T
Q  201 ggaggtctc 209  Q
    |||||||||    
T  32805187 ggaggtctc 32805195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 208
Target Start/End: Complemental strand, 6095930 - 6095723
Alignment:
Q  1 aagctagatacttccctcgtaccactttcttggaatcaaagattggatttcaacccagctatgcttggagaagtctgttgtctgcaaaaggggttattga 100  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  6095930 aagctagatacttccctcgtaccactttcttggaagcaaagattggatttcaacccagctatgcttggagaagtctgttgtctgcaaaaggggttattga 6095831  T
Q  101 aactggtgcaagatgggaaataggggatgggagtcttgtctgcatcttcaaagataggtggatcccttgttccaatggttttcttctcaacattccggga 200  Q
    |||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
T  6095830 aactagtgcaagatgggaaataggggatgggagtcttgtccgcatcttcaaagataggtggatcccttgttccaatggttttcttctcaacaatccggga 6095731  T
Q  201 ggaggtct 208  Q
    ||||||||    
T  6095730 ggaggtct 6095723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University