View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17246_low_13 (Length: 249)

Name: NF17246_low_13
Description: NF17246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17246_low_13
NF17246_low_13
[»] chr7 (2 HSPs)
chr7 (140-249)||(41527950-41528059)
chr7 (177-249)||(41511993-41512065)


Alignment Details
Target: chr7 (Bit Score: 98; Significance: 2e-48; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 140 - 249
Target Start/End: Complemental strand, 41528059 - 41527950
Alignment:
Q  140 ttattgatttacaatttcatgatagaatcaaacaaacaaatgacagcttgtcattagacaatcttcaacatataaacaaaatgaagtgaaaacatatagt 239  Q
    |||||||||||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  41528059 ttattgatttacaatttcatgataaaatcaaacaaacaagtaacagcttgtcattagacaatcttcaacatataaacaaaatgaagtgaaaacatatagt 41527960  T
Q  240 accctcttct 249  Q
    ||||||||||    
T  41527959 accctcttct 41527950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 177 - 249
Target Start/End: Complemental strand, 41512065 - 41511993
Alignment:
Q  177 aaatgacagcttgtcattagacaatcttcaacatataaacaaaatgaagtgaaaacatatagtaccctcttct 249  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
T  41512065 aaatgacagcttgtcattagacaatcttcaacatataaacaaaatgaagtgagaacatatagtaccctcttct 41511993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University