View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17231_high_10 (Length: 228)

Name: NF17231_high_10
Description: NF17231
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17231_high_10
NF17231_high_10
[»] chr5 (2 HSPs)
chr5 (17-120)||(42352797-42352900)
chr5 (114-162)||(42353719-42353767)


Alignment Details
Target: chr5 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 17 - 120
Target Start/End: Original strand, 42352797 - 42352900
Alignment:
Q  17 cctgtgaaggaattaagaggtggtgtcaaatttgctcctattggtttgataaatttgggagggggtgtcaatatcaaagagttcgattgctcgcttctga 116  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||| ||||||||||||||    
T  42352797 cctgtgaaggaattaagaggtggagtcaaatttgctcctattggtttgataaattcgagagggggtgtcaatatcaaagagttcggttgctcgcttctga 42352896  T
Q  117 aacc 120  Q
    ||||    
T  42352897 aacc 42352900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 114 - 162
Target Start/End: Original strand, 42353719 - 42353767
Alignment:
Q  114 tgaaaccctaaccttgctcattctgaaatcaactttcaaatgtaagtat 162  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||    
T  42353719 tgaaaccctaaccttgctcattctgaaatcaactttcaaatgtaagtat 42353767  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University