View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17222_high_52 (Length: 203)

Name: NF17222_high_52
Description: NF17222
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17222_high_52
NF17222_high_52
[»] chr4 (2 HSPs)
chr4 (60-185)||(25656375-25656500)
chr4 (12-42)||(25656343-25656373)


Alignment Details
Target: chr4 (Bit Score: 102; Significance: 7e-51; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 102; E-Value: 7e-51
Query Start/End: Original strand, 60 - 185
Target Start/End: Original strand, 25656375 - 25656500
Alignment:
Q  60 tgattgtaatcgaatgattatagtgaattaagtcttcaactatagagagacaaattatgtccgcagacgagactaaaggcagctgtcggttagattgcga 159  Q
    ||||||||||||||||||||||||||||||||||||| ||| |||||||||||||| ||||||||||||||||||||||||||||||||| |||||| ||    
T  25656375 tgattgtaatcgaatgattatagtgaattaagtcttcgactgtagagagacaaattctgtccgcagacgagactaaaggcagctgtcggtcagattgtga 25656474  T
Q  160 accaatataaaacataatgcgtcttt 185  Q
    ||||||||||||||||||| ||||||    
T  25656475 accaatataaaacataatgtgtcttt 25656500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 12 - 42
Target Start/End: Original strand, 25656343 - 25656373
Alignment:
Q  12 gaagaaaatctgatgtacgaccagtttgcaa 42  Q
    |||||||||||||||||||||||||||||||    
T  25656343 gaagaaaatctgatgtacgaccagtttgcaa 25656373  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University