View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1721_low_57 (Length: 214)

Name: NF1721_low_57
Description: NF1721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1721_low_57
NF1721_low_57
[»] chr2 (1 HSPs)
chr2 (1-197)||(33651970-33652168)


Alignment Details
Target: chr2 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 1 - 197
Target Start/End: Original strand, 33651970 - 33652168
Alignment:
Q  1 ctgatatatgtaggacatgctatagaatgaacttggttggtttcaactttttatgnnnnnnnacgacaaggacaataatcacaacatgttatgttttaac 100  Q
    |||||||||||||||||||||||||||||||||| ||||||||||||||||||||       ||||||||||||||||||||||||||||||||||||||    
T  33651970 ctgatatatgtaggacatgctatagaatgaactttgttggtttcaactttttatgtttttttacgacaaggacaataatcacaacatgttatgttttaac 33652069  T
Q  101 ttgt-aaattatattnnnnnnnntcatagtttagttttctgttaca---tagtagtacaaaatcgccaacttggttttagtttgtcttctttcatgtgtt 196  Q
    |||| ||||||||||        ||  |||||||||||||||||||   |||||||||| ||||||||||||||||||||||||||||||||||||||||    
T  33652070 ttgtaaaattatattaaaaaaaatc--agtttagttttctgttacatagtagtagtacataatcgccaacttggttttagtttgtcttctttcatgtgtt 33652167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University