View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1721_low_48 (Length: 236)

Name: NF1721_low_48
Description: NF1721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1721_low_48
NF1721_low_48
[»] chr5 (2 HSPs)
chr5 (104-219)||(276746-276861)
chr5 (1-95)||(276608-276702)


Alignment Details
Target: chr5 (Bit Score: 104; Significance: 6e-52; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 104 - 219
Target Start/End: Original strand, 276746 - 276861
Alignment:
Q  104 aggattgcagtgtcagaaagttgattagttgaaatcttaggaaagtgagagtgcaagattaaaagtttagatgtaactaattccatttaagagaaatgaa 203  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||| |||||||||||||    
T  276746 aggattgcagtgtcagaaagttgattagttgaaatcttaggaaagtgtgagtgcaagattaaaagtttagatgtaattaattccatataagagaaatgaa 276845  T
Q  204 ttggttatagtttaac 219  Q
    ||||||||||||||||    
T  276846 ttggttatagtttaac 276861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 1 - 95
Target Start/End: Original strand, 276608 - 276702
Alignment:
Q  1 ttcaagatgtcgtcatatgcgaataaatatgagatgtgggaccaggccaccctttttcaagaaaagcatctaacccaattatcttattcttaatg 95  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||    
T  276608 ttcaagatgtcgtcatatgtgaataaatatgagatgtgggaccaggccaccctttttcaagaaaagcatctaacccaattgtcttatttttaatg 276702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University