View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1721_low_37 (Length: 250)

Name: NF1721_low_37
Description: NF1721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1721_low_37
NF1721_low_37
[»] chr6 (1 HSPs)
chr6 (103-250)||(31026244-31026403)


Alignment Details
Target: chr6 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 103 - 250
Target Start/End: Complemental strand, 31026403 - 31026244
Alignment:
Q  103 ctcacatcttatattactttggcatatttaaaatatcat--gtgaggtttcagtgttaaaactaattaaaccatcatctaaattgtaagtttataattgg 200  Q
    |||||||||||||||||||| ||||||||||||||||||  ||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||    
T  31026403 ctcacatcttatattactttcgcatatttaaaatatcatatgtgaggttttagtgttaaaactaattaaagcatcatctaaattgtaagtttataattgg 31026304  T
Q  201 cag----------gacgaaattctaaattgtttggttcccttcactcatactagacaaat 250  Q
    |||          ||| |||||||||||||||||||||||||||||||||||||||||||    
T  31026303 cagtttaggacttgacaaaattctaaattgtttggttcccttcactcatactagacaaat 31026244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University