View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17219_low_5 (Length: 366)

Name: NF17219_low_5
Description: NF17219
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17219_low_5
NF17219_low_5
[»] chr1 (2 HSPs)
chr1 (3-93)||(47321319-47321409)
chr1 (287-347)||(47321255-47321315)


Alignment Details
Target: chr1 (Bit Score: 91; Significance: 5e-44; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 3 - 93
Target Start/End: Complemental strand, 47321409 - 47321319
Alignment:
Q  3 ttttagaaatattgaagcttttcaaagctgtaagagttggaacaggtgaagctgacacagaaagatcgaagaagctggaacaattggagaa 93  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  47321409 ttttagaaatattgaagcttttcaaagctgtaagagttggaacaggtgaagctgacacagaaagatcgaagaagctggaacaattggagaa 47321319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 287 - 347
Target Start/End: Complemental strand, 47321315 - 47321255
Alignment:
Q  287 ttataataatgtgaggaatttgtttatgatttatgtgaatttgctttctatgtgtaataca 347  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  47321315 ttataataatgtgaggaatttgtttatgatttatgtgaatttgctttctatgtgtaataca 47321255  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University