View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17218_high_22 (Length: 276)

Name: NF17218_high_22
Description: NF17218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17218_high_22
NF17218_high_22
[»] chr8 (1 HSPs)
chr8 (196-232)||(3402402-3402438)


Alignment Details
Target: chr8 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 196 - 232
Target Start/End: Original strand, 3402402 - 3402438
Alignment:
Q  196 aacaatcttactatatgatgaggatcaatatggagtt 232  Q
    |||||| ||||||||||||||||||||||||||||||    
T  3402402 aacaattttactatatgatgaggatcaatatggagtt 3402438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University