View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17215_low_48 (Length: 238)

Name: NF17215_low_48
Description: NF17215
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17215_low_48
NF17215_low_48
[»] chr6 (2 HSPs)
chr6 (138-232)||(12730212-12730306)
chr6 (104-146)||(12730650-12730692)


Alignment Details
Target: chr6 (Bit Score: 63; Significance: 2e-27; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 138 - 232
Target Start/End: Complemental strand, 12730306 - 12730212
Alignment:
Q  138 ttcaatatatcaaccaagttgtatttatacattttagttgatagaacattaattaaatatcttaacataagtaatctgatcgacttcatctcact 232  Q
    |||||||||||||| |||||||||||||||| ||||||||||||| ||||||| ||||||||||||  |||||||||||||||||| || |||||    
T  12730306 ttcaatatatcaacgaagttgtatttatacactttagttgatagagcattaatgaaatatcttaacccaagtaatctgatcgactttatatcact 12730212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 104 - 146
Target Start/End: Complemental strand, 12730692 - 12730650
Alignment:
Q  104 ttgagaacacacttagagcttaaatttatatcctttcaatata 146  Q
    |||||||||||||||||||||||||||||||||||||||||||    
T  12730692 ttgagaacacacttagagcttaaatttatatcctttcaatata 12730650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University