View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17215_high_47 (Length: 241)

Name: NF17215_high_47
Description: NF17215
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17215_high_47
NF17215_high_47
[»] chr3 (1 HSPs)
chr3 (23-224)||(25256203-25256404)


Alignment Details
Target: chr3 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 23 - 224
Target Start/End: Original strand, 25256203 - 25256404
Alignment:
Q  23 gtcagtattgtgtctagtattcgtgtcagtattttgattttccaatccaatatccaacnnnnnnngtaatttaaataaattcatacaagaggttgaaaaa 122  Q
    ||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||    
T  25256203 gtcagtattgtgtctggtattcgtgtcggtattttgattttccaatccaatatccaactttttttgtaatttaaataaattcatacaagaggttgaaaaa 25256302  T
Q  123 gtggcatactcactctatccatgttacacagaagaaaagcagagaagcaaagaataacaataacccatctcttaggaaaaacttcccaccaaggtgaaga 222  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
T  25256303 gtggcatactcactctgtccatgttacacagaagaaaagcagagaagcaaagaataacaataacccatctcttaggaaaaacttcccaccaagatgaaga 25256402  T
Q  223 ct 224  Q
    ||    
T  25256403 ct 25256404  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University