View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17210_low_35 (Length: 214)

Name: NF17210_low_35
Description: NF17210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17210_low_35
NF17210_low_35
[»] chr3 (1 HSPs)
chr3 (1-198)||(40965707-40965906)


Alignment Details
Target: chr3 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 40965707 - 40965906
Alignment:
Q  1 gatgatgttgaatttgaagacggtaggtagaactgaactactatgagtttcttaactacttttttcgatatactttaattaannnnnnnn--atacagag 98  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |          ||||||||    
T  40965707 gatgatgttgaatttgaagacggtaggtagaactgaactactatgagtttcttaactacttttttcgatatactttaattgattttttttttatacagag 40965806  T
Q  99 accgaaatggatgaggatagcgtcgagttctatgacgaagaagaggaggatagtgtgccctatgtaagttttgatggaaaactcatttttgcatacatat 198  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
T  40965807 accgaaatggatgaggatagcgtcgagttctatgacgaagaagaggaggatagtgtgccctatgtaagttttgatggaaaactcaattttgcatacatat 40965906  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University