View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17210_low_28 (Length: 230)

Name: NF17210_low_28
Description: NF17210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17210_low_28
NF17210_low_28
[»] chr4 (1 HSPs)
chr4 (16-226)||(42392805-42393015)


Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 16 - 226
Target Start/End: Complemental strand, 42393015 - 42392805
Alignment:
Q  16 aaattgttcaaaacttcaatattgttaagaatagcaattcaatgagcttctacttacggagagcaccatttatcattgctggagtttttaacaattttca 115  Q
    |||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||    
T  42393015 aaattgttcaaaacttcaatgttgttaagaatagcaattcaacgagcttctacttacggagagcaccattgatcattgctagagtttttaacaattttca 42392916  T
Q  116 agtatttgtctgacatacaccatatgagacacttctctaccctagaaaccacctatcatatgaatattgatcaagggaatctagattcagcactcaatgc 215  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
T  42392915 agtatttgtctaacatacaccatatgagacacttctctaccctagaaaccacctatcatatgaatattgatcaagggaatctagattcagcgctcaatgc 42392816  T
Q  216 tagtataatct 226  Q
    |||||||||||    
T  42392815 tagtataatct 42392805  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University