View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1720_low_98 (Length: 234)

Name: NF1720_low_98
Description: NF1720
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1720_low_98
NF1720_low_98
[»] chr8 (2 HSPs)
chr8 (82-212)||(25868318-25868447)
chr8 (1-52)||(25868188-25868240)


Alignment Details
Target: chr8 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 82 - 212
Target Start/End: Original strand, 25868318 - 25868447
Alignment:
Q  82 gatgatagtggaacgatattggtgagactcattatctcattatctttagaaagtgggaaatatacnnnnnnnnnntggaaaaatctcacattttttagac 181  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||          |||||||||||||||||||||||||    
T  25868318 gatgatagtggaacgatattggtgagactcattatctcattatctttagaaagtgggaaatatac-aaaaaaaaatggaaaaatctcacattttttagac 25868416  T
Q  182 aagtattttgtgaagattcttttaaaatgat 212  Q
    |||||||||||||||||||||||||||||||    
T  25868417 aagtattttgtgaagattcttttaaaatgat 25868447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 25868188 - 25868240
Alignment:
Q  1 aaaaaataaaagtgaaatgatgag-aaaaattattagtacagttgtggtaaac 52  Q
    |||||||||||||||||||||||| ||||| ||||||||||||||||||||||    
T  25868188 aaaaaataaaagtgaaatgatgagaaaaaaatattagtacagttgtggtaaac 25868240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University