View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17203_low_77 (Length: 298)

Name: NF17203_low_77
Description: NF17203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17203_low_77
NF17203_low_77
[»] chr3 (1 HSPs)
chr3 (16-287)||(54161655-54161919)


Alignment Details
Target: chr3 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 16 - 287
Target Start/End: Complemental strand, 54161919 - 54161655
Alignment:
Q  16 atgaatctgaggataacggtgtaggtaggttaaattgtaaaatactac---ctgtaatcgattaactttccttgacgctggcccttggcatccaagcgat 112  Q
    |||||||| ||||||| |||||||||||||||||||||||||||||||   |||||||||||||||||||||||||||||||||||||| ||||||||||    
T  54161919 atgaatctcaggataaaggtgtaggtaggttaaattgtaaaatactactacctgtaatcgattaactttccttgacgctggcccttggcgtccaagcgat 54161820  T
Q  113 ggcgcatatccaaatgattgcgaggcttctcctg--tttaaatacatattcaactattgaatgaatgatataaatatattacagacacagcaagctaatt 210  Q
    ||||||||||||||||||||||||||||||||||  |||||||||| ||||||| |||||||||||            |||||||||||||| |||||||    
T  54161819 ggcgcatatccaaatgattgcgaggcttctcctgtttttaaatacaaattcaacgattgaatgaat------------ttacagacacagcaggctaatt 54161732  T
Q  211 gaatgaatgtaaaaaatgttacttacacgggcaagtccaatctctagctccccctgcaacacaacataggatcggat 287  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
T  54161731 gaatgaatgtaaaaaatgttacttacacgggcaagtccaatctctagctccccctgcaacaaaacataggatcggat 54161655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University