View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17203_low_111 (Length: 238)

Name: NF17203_low_111
Description: NF17203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17203_low_111
NF17203_low_111
[»] chr6 (1 HSPs)
chr6 (1-223)||(28657320-28657544)


Alignment Details
Target: chr6 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 28657544 - 28657320
Alignment:
Q  1 ccagcaaatttgtaaatcaacactttgataatttcagcctgctaacttgcactcagattaggatagtttgatcggccctatgtcacgttctatttgcgcc 100  Q
    ||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  28657544 ccagcaaatttgtaaatcagcactttgacaatttcagcctgctaacttgcactcagattaggatagtttgatcggccctatgtcacgttctatttgcgcc 28657445  T
Q  101 accccacttaggacccaaataaga--gtgtcctctcaaatcacccatagaagagcaactcggtactatgaaactcttaccatgtccatgtccagggaaga 198  Q
    |||||||||||||||||||| |||  ||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||    
T  28657444 accccacttaggacccaaatgagagtgtgtcctctgaaatcacccatagaagagcaacccggtactatgaaactcttaccatgtccaggtccagggaaga 28657345  T
Q  199 gtgagatccattgttgattcattat 223  Q
    ||||||||||||||||||| |||||    
T  28657344 gtgagatccattgttgatttattat 28657320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University