View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17203_high_83 (Length: 270)

Name: NF17203_high_83
Description: NF17203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17203_high_83
NF17203_high_83
[»] chr2 (1 HSPs)
chr2 (75-265)||(39983738-39983928)


Alignment Details
Target: chr2 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 75 - 265
Target Start/End: Complemental strand, 39983928 - 39983738
Alignment:
Q  75 cttcttaaatattggcaaattttggaatcttattgnnnnnnngcaagtcatagatttataaatcattgatgaatggctaatgtgagtgacaaattataaa 174  Q
    |||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  39983928 cttcttaaatattggcaaattttggaatcttattgtttttttgcaagtcatagatttataaatcattgatgaatggctaatgtgagtgacaaattataaa 39983829  T
Q  175 tcataactttatagattcttttgttgaatttctcctcgggatccaaatactagtgttatactaatgatgcagcaattgcttctctgctcct 265  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
T  39983828 tcataactttatagattcttttgttgaatttctcctcgggatccaaatactagtgttatactaatgatgcagcaattgcttctttgctcct 39983738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University