View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17202_low_52 (Length: 215)

Name: NF17202_low_52
Description: NF17202
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17202_low_52
NF17202_low_52
[»] chr4 (1 HSPs)
chr4 (53-145)||(2167131-2167224)


Alignment Details
Target: chr4 (Bit Score: 74; Significance: 4e-34; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 53 - 145
Target Start/End: Complemental strand, 2167224 - 2167131
Alignment:
Q  53 tttatgcaaaattcagattttgatatttaatttgttgctcatc-ctcatggaagcaatgaaatgtttttgtgatgtcatttaatatatatcttt 145  Q
    |||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||| | |||||||    
T  2167224 tttatgcaaaattcagattttgatatttaatttgttgctcatcgatcatggaagcaatgaaatgtttttgtgatgtcatttaatctttatcttt 2167131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University