View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17198_high_46 (Length: 219)

Name: NF17198_high_46
Description: NF17198
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17198_high_46
NF17198_high_46
[»] chr4 (1 HSPs)
chr4 (69-203)||(37294512-37294645)


Alignment Details
Target: chr4 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 69 - 203
Target Start/End: Original strand, 37294512 - 37294645
Alignment:
Q  69 tcagatattgccatatacttacaaattacaatgttagtgattgatttgttagaggaggaaaaagtgtctctgtcagtaacat--atcgagccctaaactt 166  Q
    ||||||||||||||||| |||||||||||||||||||||||||||||||||   |||||||||||||| || ||||||||||  ||||||| |||| |||    
T  37294512 tcagatattgccatatatttacaaattacaatgttagtgattgatttgtta---gaggaaaaagtgtcactttcagtaacatgaatcgagctctaatctt 37294608  T
Q  167 cttacatatacctaactcctttaatattctaattcat 203  Q
    |||| |||||||||||||||| |||| ||||||||||    
T  37294609 cttagatatacctaactccttcaatactctaattcat 37294645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University