View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17196_low_33 (Length: 250)

Name: NF17196_low_33
Description: NF17196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17196_low_33
NF17196_low_33
[»] chr7 (2 HSPs)
chr7 (1-86)||(40223959-40224044)
chr7 (151-237)||(40223808-40223894)


Alignment Details
Target: chr7 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 1 - 86
Target Start/End: Complemental strand, 40224044 - 40223959
Alignment:
Q  1 aatttagaaccaaaaaactttatatgtgtgaattagataaaactaggatatggataaatcgatacaactaattagacttaggtgca 86  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
T  40224044 aatttagaacgaaaaaactttatatgtgtgaattagataaaactaggatatcgataaatcgatacaactaattagacttaggtgca 40223959  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 151 - 237
Target Start/End: Complemental strand, 40223894 - 40223808
Alignment:
Q  151 ataccagcacttactatattttttaagttaatgtannnnnnnggttcgggttgatgtctgactaattaataatatttggtccttgtt 237  Q
    ||||||||||||||||||||||| |||||||||||       |||||||||||||||||||||||||||||||||||||||||||||    
T  40223894 ataccagcacttactatatttttgaagttaatgtatttttttggttcgggttgatgtctgactaattaataatatttggtccttgtt 40223808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University