View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17196_high_25 (Length: 261)

Name: NF17196_high_25
Description: NF17196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17196_high_25
NF17196_high_25
[»] chr8 (1 HSPs)
chr8 (12-246)||(1008381-1008615)
[»] chr1 (1 HSPs)
chr1 (17-73)||(18652894-18652950)
[»] chr4 (1 HSPs)
chr4 (21-57)||(19720012-19720048)


Alignment Details
Target: chr8 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 12 - 246
Target Start/End: Complemental strand, 1008615 - 1008381
Alignment:
Q  12 ttctttggatcccttatctccgcagcaaatttcccccatggccttcacctcacacctctatacctcttccattctggtattggagtgtgaggtttatgga 111  Q
    |||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||    
T  1008615 ttctttggatcccttatctctgcagcaaatttcccccatggccttcgcctcacacctctatacctcttccattctggtattggaatgtgaggtttatgga 1008516  T
Q  112 tcatcgatgatgatccatttttacacgcggcatcatcaacattgtcagtgttgttaacaaccaatgttggactagtaaatgaatcgtgcgaggatggatc 211  Q
    ||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  1008515 tcatcgatgatgatccatttttacatgcggcatcattaacattgtcagtgttgttaacaaccaatgttggactagtaaatgaatcgtgcgaggatggatc 1008416  T
Q  212 tgaggcatggtgggtggaattagtattcatgatga 246  Q
    |||||||||||||||||||||||||||||||||||    
T  1008415 tgaggcatggtgggtggaattagtattcatgatga 1008381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 17 - 73
Target Start/End: Complemental strand, 18652950 - 18652894
Alignment:
Q  17 tggatcccttatctccgcagcaaatttcccccatggccttcacctcacacctctata 73  Q
    ||||||||||||||| || |||||||||||||||||||||| ||| |||||||||||    
T  18652950 tggatcccttatctcagctgcaaatttcccccatggccttctccttacacctctata 18652894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 21 - 57
Target Start/End: Original strand, 19720012 - 19720048
Alignment:
Q  21 tcccttatctccgcagcaaatttcccccatggccttc 57  Q
    |||||||||||||| || |||||||||||||||||||    
T  19720012 tcccttatctccgccgcgaatttcccccatggccttc 19720048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University