View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17191_low_5 (Length: 348)

Name: NF17191_low_5
Description: NF17191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17191_low_5
NF17191_low_5
[»] chr1 (2 HSPs)
chr1 (1-193)||(21283287-21283479)
chr1 (269-333)||(21283555-21283619)


Alignment Details
Target: chr1 (Bit Score: 165; Significance: 3e-88; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 1 - 193
Target Start/End: Original strand, 21283287 - 21283479
Alignment:
Q  1 tggggagattcctcaggtggagtccttgcttaatcaaggacctactgctttttcaggaaacccaggactttgtgggtttccgttaaggaacctttgtcca 100  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||| |    
T  21283287 tggggagattcctcaggtggggtccttgcttaatcaaggacctactgctttttcaggaaacccaggactttgtgggtttccgttgaggaatctttgtcaa 21283386  T
Q  101 gatgagacaaaggttcctgattatttaccggagaatccggatactaacccgaatgcagttcggactgaaccagttcaagatgggagggggagg 193  Q
    || ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
T  21283387 gacgagacaaaggttcctgactatttaccggagaatccggatactaacccgaatgcagttcggactgaaccggttcaagatgggagggggagg 21283479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 269 - 333
Target Start/End: Original strand, 21283555 - 21283619
Alignment:
Q  269 aggaggcggcggaggaggttgaatgatggggaagttgggtttgaaaaggggaaggtggagggtga 333  Q
    |||||||| |||||||||||||||||| |||||| |||||||||||||||||| ||||| |||||    
T  21283555 aggaggcgacggaggaggttgaatgatagggaaggtgggtttgaaaaggggaaagtggaaggtga 21283619  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University