View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1718_high_29 (Length: 214)

Name: NF1718_high_29
Description: NF1718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1718_high_29
NF1718_high_29
[»] chr8 (2 HSPs)
chr8 (19-199)||(10862380-10862560)
chr8 (120-169)||(40011044-40011093)
[»] scaffold0227 (1 HSPs)
scaffold0227 (71-190)||(3467-3586)
[»] chr5 (1 HSPs)
chr5 (111-166)||(16865530-16865585)


Alignment Details
Target: chr8 (Bit Score: 129; Significance: 6e-67; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 19 - 199
Target Start/End: Original strand, 10862380 - 10862560
Alignment:
Q  19 aaaatggaggtatatgtggacttcagtccaacacgaaccacttttgttcgacgaggacttttttagtaggtttgaggatcttgatgaccctggccctgag 118  Q
    ||||||||| |||||||||||||||||   | ||||||  ||||| |||||| ||||||||||||| ||||||||||||| ||||| |||||||||| ||    
T  10862380 aaaatggagctatatgtggacttcagtttgatacgaacaccttttattcgacaaggacttttttagaaggtttgaggatcatgatggccctggcccttag 10862479  T
Q  119 atttctagaattatcactgaagttcttttccttcacaatgggccgatatatggttttgctcttgacatccctatccctatg 199  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  10862480 atttctagaattatcactgaagttcttttccttcacaatgggccgatatatggttttgctcttgacatccctatccctatg 10862560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 120 - 169
Target Start/End: Complemental strand, 40011093 - 40011044
Alignment:
Q  120 tttctagaattatcactgaagttcttttccttcacaatgggccgatatat 169  Q
    |||| ||||||||||| |||||||||||||| |||||||| |||||||||    
T  40011093 tttcaagaattatcacggaagttcttttcctccacaatggaccgatatat 40011044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0227 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: scaffold0227
Description:

Target: scaffold0227; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 71 - 190
Target Start/End: Complemental strand, 3586 - 3467
Alignment:
Q  71 gaggacttttttagtaggtttgaggatcttgatgaccctggccctgagatttctagaattatcactgaagttcttttccttcacaatgggccgatatatg 170  Q
    |||||||| ||| ||||||| ||||||||| |||||||||||||||||||||||||||||||||| ||| ||||||| || ||||||||||||||||||     
T  3586 gaggacttcttttgtaggttcgaggatcttaatgaccctggccctgagatttctagaattatcaccgaaattcttttactccacaatgggccgatatata 3487  T
Q  171 gttttgctcttgacatccct 190  Q
    | |||  |||||| ||||||    
T  3486 gatttattcttgatatccct 3467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 111 - 166
Target Start/End: Original strand, 16865530 - 16865585
Alignment:
Q  111 gccctgagatttctagaattatcactgaagttcttttccttcacaatgggccgata 166  Q
    |||||||| ||| || ||||||||| ||||||||||| || |||||||||||||||    
T  16865530 gccctgaggtttgtataattatcacggaagttcttttgctccacaatgggccgata 16865585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University