View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17189_low_4 (Length: 431)

Name: NF17189_low_4
Description: NF17189
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17189_low_4
NF17189_low_4
[»] chr7 (1 HSPs)
chr7 (11-224)||(43976049-43976274)
[»] chr5 (2 HSPs)
chr5 (24-137)||(18021535-18021645)
chr5 (371-407)||(5961957-5961993)
[»] chr3 (2 HSPs)
chr3 (371-407)||(31646881-31646917)
chr3 (209-245)||(31647047-31647083)


Alignment Details
Target: chr7 (Bit Score: 157; Significance: 2e-83; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 11 - 224
Target Start/End: Complemental strand, 43976274 - 43976049
Alignment:
Q  11 caaaggggctaaaaaggatgtgggggagatttttgatgcggttaagaccttatcttggtgttggtgtcttaatagtagattggaaattggtgcttttatg 110  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||   |||||||||||||||||||||||||    
T  43976274 caaaggggctaaaaaggatgtgggggagatttttgatgcggttaagaccttatcttggtgttggtgtcgtaa---tagattggaaattggtgcttttatg 43976178  T
Q  111 ttcttcgaatggtgttggaat---------------tctaggtaggtgttttttggtgcagctgcccggattgtggtgcggtgtacaaatagcccaactg 195  Q
    |||||| ||||||||||||||               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  43976177 ttcttcaaatggtgttggaattctagggattgtttatctaggtaggtgttttttggtgcagctgcccggattgtggtgcggtgtacaaatagcccaactg 43976078  T
Q  196 cacggcagtttgttttagcctacagttgg 224  Q
    |||||||||||||||||||||||||||||    
T  43976077 cacggcagtttgttttagcctacagttgg 43976049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 48; Significance: 3e-18; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 24 - 137
Target Start/End: Complemental strand, 18021645 - 18021535
Alignment:
Q  24 aaggatgtgggggagatttttgatgcggttaagaccttatcttggtgttggtgtcttaatagtagattggaaattggtgcttttatgttcttcgaatggt 123  Q
    ||||| ||||| ||||||||||| ||| | ||||| |||||||||||||||||||| ||   ||||||| |||| ||||| ||| ||||||| |||||||    
T  18021645 aaggaggtgggtgagatttttgacgcgataaagactttatcttggtgttggtgtctcaa---tagattgaaaataggtgcatttgtgttctttgaatggt 18021549  T
Q  124 gttggaattctagg 137  Q
    |||||||| |||||    
T  18021548 gttggaatcctagg 18021535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 371 - 407
Target Start/End: Original strand, 5961957 - 5961993
Alignment:
Q  371 ttcgccccttcctcttttcttatgaggttgggtgcct 407  Q
    ||||||||||||||| |||||||||||||||| ||||    
T  5961957 ttcgccccttcctctcttcttatgaggttgggagcct 5961993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 29; Significance: 0.0000006; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 371 - 407
Target Start/End: Complemental strand, 31646917 - 31646881
Alignment:
Q  371 ttcgccccttcctcttttcttatgaggttgggtgcct 407  Q
    ||||||||||||||| |||||||||||||||| ||||    
T  31646917 ttcgccccttcctctcttcttatgaggttgggagcct 31646881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 209 - 245
Target Start/End: Complemental strand, 31647083 - 31647047
Alignment:
Q  209 tttagcctacagttggtttaatttgttgctggttttt 245  Q
    |||||||| ||||||||||| ||||||||||||||||    
T  31647083 tttagccttcagttggtttagtttgttgctggttttt 31647047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University