View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1718-Insertion-2 (Length: 255)

Name: NF1718-Insertion-2
Description: NF1718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1718-Insertion-2
NF1718-Insertion-2
[»] chr7 (1 HSPs)
chr7 (76-196)||(38348804-38348924)


Alignment Details
Target: chr7 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 76 - 196
Target Start/End: Original strand, 38348804 - 38348924
Alignment:
Q  76 catgccaacctggttttactgtttcttgttgactcttaatttctatgaatagtatatttttatattgtcctttactttggctttcttgacctagattgtt 175  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
T  38348804 catgccaacctggttttactgtttcttgttgactcttaatttctatgaatagtatatttttatattgtcctttactttggttttcttgacctagattgtt 38348903  T
Q  176 attttaggtcttggttcattg 196  Q
    |||||||||||||||||||||    
T  38348904 attttaggtcttggttcattg 38348924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University