View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1717_high_28 (Length: 236)

Name: NF1717_high_28
Description: NF1717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1717_high_28
NF1717_high_28
[»] chr6 (1 HSPs)
chr6 (1-103)||(26194960-26195062)


Alignment Details
Target: chr6 (Bit Score: 82; Significance: 7e-39; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 1 - 103
Target Start/End: Original strand, 26194960 - 26195062
Alignment:
Q  1 cttttgggaattgcattccactacccttttgagcacttatcaaaagaacctctatttccttttcttgggttccattcnnnnnnnatctataaggtatgca 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||    
T  26194960 cttttgggaattgcattccactacccttttgagcacttatcaaaagaacctctatttccttttcttgggttccattctttttgtatctataaggtatgca 26195059  T
Q  101 tct 103  Q
    |||    
T  26195060 tct 26195062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University