View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1717R-Insertion-1 (Length: 112)

Name: NF1717R-Insertion-1
Description: NF1717R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1717R-Insertion-1
NF1717R-Insertion-1
[»] chr7 (1 HSPs)
chr7 (16-112)||(36026472-36026568)
[»] chr1 (1 HSPs)
chr1 (25-102)||(16933824-16933901)


Alignment Details
Target: chr7 (Bit Score: 93; Significance: 9e-46; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 93; E-Value: 9e-46
Query Start/End: Original strand, 16 - 112
Target Start/End: Original strand, 36026472 - 36026568
Alignment:
Q  16 atatgatgatgccattttccaaccccagttggataagtatgaaacttgtctggatacatagcctgtttaatttctgtttttgtatttgtaagttttt 112  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  36026472 atatgatgatgccatttttcaaccccagttggataagtatgaaacttgtctggatacatagcctgtttaatttctgtttttgtatttgtaagttttt 36026568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 30; Significance: 0.00000003; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000003
Query Start/End: Original strand, 25 - 102
Target Start/End: Complemental strand, 16933901 - 16933824
Alignment:
Q  25 tgccattttccaaccccagttggataagtatgaaacttgtctggatacatagcctgtttaatttctgtttttgtattt 102  Q
    ||||||||| || ||  |||||||||| ||| ||| |||||||||| |||||||||||| ||||   |||||||||||    
T  16933901 tgccatttttcagccatagttggataactattaaatttgtctggattcatagcctgttttattttcttttttgtattt 16933824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University