View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17176_high_10 (Length: 440)

Name: NF17176_high_10
Description: NF17176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17176_high_10
NF17176_high_10
[»] chr3 (2 HSPs)
chr3 (1-130)||(54436707-54436836)
chr3 (276-337)||(54436982-54437043)


Alignment Details
Target: chr3 (Bit Score: 122; Significance: 2e-62; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 1 - 130
Target Start/End: Original strand, 54436707 - 54436836
Alignment:
Q  1 tcgacggcaacgtggatctgttcttcttgggtttgacactgttgaaagaggatttgtgagtgagggacaatttgtcactgtatttttgtttgtggttgtt 100  Q
    |||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  54436707 tcgacggcaacgtggatctgttcttcttcgatttgacactgttgaaagaggatttgtgagtgagggacaatttgtcactgtatttttgtttgtggttgtt 54436806  T
Q  101 ccatccaattttttgttgacactctttcaa 130  Q
    ||||||||||||||||||||||||||||||    
T  54436807 ccatccaattttttgttgacactctttcaa 54436836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 276 - 337
Target Start/End: Original strand, 54436982 - 54437043
Alignment:
Q  276 ctgggatgaaatttgttgagagagatttgtcactgccttttgagttatttgcagggatgaaa 337  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  54436982 ctgggatgaaatttgttgagagagatttgtcactgccttttgagttatttgcagggatgaaa 54437043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University