View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17175_low_1 (Length: 325)

Name: NF17175_low_1
Description: NF17175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17175_low_1
NF17175_low_1
[»] chr1 (1 HSPs)
chr1 (1-144)||(42608975-42609118)


Alignment Details
Target: chr1 (Bit Score: 144; Significance: 1e-75; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 1 - 144
Target Start/End: Complemental strand, 42609118 - 42608975
Alignment:
Q  1 aaaattaggtcacctggtgaggactgtgataaggttttcacagcaatgtgtgatggaaggtttattgatcccatgttggattgtctaaaggagtggaatg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  42609118 aaaattaggtcacctggtgaggactgtgataaggttttcacagcaatgtgtgatggaaggtttattgatcccatgttggattgtctaaaggagtggaatg 42609019  T
Q  101 gtgttcctctacctatctgctaggattgtgctactctaatgtaa 144  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
T  42609018 gtgttcctctacctatctgctaggattgtgctactctaatgtaa 42608975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University