View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17173_high_6 (Length: 234)

Name: NF17173_high_6
Description: NF17173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17173_high_6
NF17173_high_6
[»] chr2 (1 HSPs)
chr2 (1-207)||(36759580-36759786)


Alignment Details
Target: chr2 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 207
Target Start/End: Complemental strand, 36759786 - 36759580
Alignment:
Q  1 gttgggctagtacatgaatgtatgcgggtttagaaagaaaggaaaataatacacataataaagcttgaaaattaaaatttactgaattacctgaggcagc 100  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  36759786 gttgggctagtacatgaatgcatgcgggtttagaaagaaaggaaaataatacacataataaagcttgaaaattaaaatttactgaattacctgaggcagc 36759687  T
Q  101 aaaacaacatccaacagagatatagacctaaaattttatgatgcaaatgttaggaataatggttgtagttgatggatggtagtgaaagagggagaagtga 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  36759686 aaaacaacatccaacagagatatagacctaaaattttatgatgcaaatgttaggaataatggttgtagttgatggatggtagtgaaagagggagaagtga 36759587  T
Q  201 tgagtat 207  Q
     ||||||    
T  36759586 ggagtat 36759580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University