View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17171_low_5 (Length: 239)

Name: NF17171_low_5
Description: NF17171
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17171_low_5
NF17171_low_5
[»] chr3 (2 HSPs)
chr3 (17-222)||(4809211-4809413)
chr3 (17-49)||(4668315-4668347)


Alignment Details
Target: chr3 (Bit Score: 172; Significance: 1e-92; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 17 - 222
Target Start/End: Original strand, 4809211 - 4809413
Alignment:
Q  17 aggaatgagaatcagagatgcaaggaacaacactagaaatgatagggaaaaagaagccattcttagttactgattttcagtcttggtgtacaaaacatag 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  4809211 aggaatgagaatcagagatgcaaggaacaacactagaaatgatagggaaaaagaagccattcttagttactgattttcagtcttggtgtacaaaacatag 4809310  T
Q  117 ggagtactactcatgttttatactggattgttaggaggatcaatgagtgggtggggggttgtgcaattattgattagattacgtcagggctgatgtcaca 216  Q
    ||||||||||||||||||||||||||||||||||| |||||||||||||   |||||   |||||||||||||||||||||||||||||||||||||| |    
T  4809311 ggagtactactcatgttttatactggattgttagggggatcaatgagtgaagggggg---gtgcaattattgattagattacgtcagggctgatgtcata 4809407  T
Q  217 tgccta 222  Q
    ||||||    
T  4809408 tgccta 4809413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 17 - 49
Target Start/End: Original strand, 4668315 - 4668347
Alignment:
Q  17 aggaatgagaatcagagatgcaaggaacaacac 49  Q
    ||||||||||||||||||||||||||| |||||    
T  4668315 aggaatgagaatcagagatgcaaggaaaaacac 4668347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University