View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17168_high_72 (Length: 250)

Name: NF17168_high_72
Description: NF17168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17168_high_72
NF17168_high_72
[»] chr1 (1 HSPs)
chr1 (106-240)||(30654536-30654670)
[»] chr4 (1 HSPs)
chr4 (184-237)||(38927753-38927806)


Alignment Details
Target: chr1 (Bit Score: 131; Significance: 5e-68; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 106 - 240
Target Start/End: Original strand, 30654536 - 30654670
Alignment:
Q  106 taaggacggcgaccatccttataccatatatactctgtcccattattataatattaataatgttatagtattattcactgtggggtttgcaactgccatt 205  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  30654536 taaggacggcgaccatccttataccatatatactctgtcccataattataatattaataatgttatagtattattcactgtggggtttgcaactgccatt 30654635  T
Q  206 tgttgtgctcgtcgttattgtttttgcgacctatg 240  Q
    |||||||||||||||||||||||||||||||||||    
T  30654636 tgttgtgctcgtcgttattgtttttgcgacctatg 30654670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 184 - 237
Target Start/End: Original strand, 38927753 - 38927806
Alignment:
Q  184 tgtggggtttgcaactgccatttgttgtgctcgtcgttattgtttttgcgacct 237  Q
    ||||||||||||||| || ||| ||||||||||||||| ||||||| |||||||    
T  38927753 tgtggggtttgcaaccgctattggttgtgctcgtcgttgttgttttggcgacct 38927806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University