View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17166_low_94 (Length: 251)

Name: NF17166_low_94
Description: NF17166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17166_low_94
NF17166_low_94
[»] chr4 (1 HSPs)
chr4 (19-210)||(55061953-55062143)
[»] chr2 (2 HSPs)
chr2 (107-210)||(40932150-40932253)
chr2 (108-199)||(40940181-40940270)


Alignment Details
Target: chr4 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 19 - 210
Target Start/End: Original strand, 55061953 - 55062143
Alignment:
Q  19 atattttaagctcagatctaattgtttatattaatttttctatatctgnnnnnnnnnnncttcttctttttactgctttcatgattggcatggttcgatc 118  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||           |||||||||||| ||||||||||||||||||||||||||||    
T  55061953 atattttaagctcagatctaattgtttatatttatttttctatatctgtttttttctt-cttcttctttttgctgctttcatgattggcatggttcgatc 55062051  T
Q  119 aataaatcatagcagggctgtaattttgcgcttttatcggttttcagtgcatgtgcaattttgtttgatatctatccctcatgcgttgtttg 210  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
T  55062052 aataaatcatagcggggctgtaattttgcgcttttatcggttttcagtgcatgtgcaatttagtttgatatctatccctcatgcgttgtttg 55062143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 48; Significance: 2e-18; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 107 - 210
Target Start/End: Original strand, 40932150 - 40932253
Alignment:
Q  107 catggttcgatcaataaatcatagcagggctgtaattttgcgcttttatcggttttcagtgcatgtgcaattttgtttgatatctatccctcatgcgttg 206  Q
    ||||||||||||||| | ||| ||||| ||||| ||||||| ||||||||  |||||  |||||||||||||||||||||| ||||| ||||||| |||     
T  40932150 catggttcgatcaatgagtcacagcagtgctgttattttgcacttttatccattttcgatgcatgtgcaattttgtttgatttctattcctcatgtgttc 40932249  T
Q  207 tttg 210  Q
    ||||    
T  40932250 tttg 40932253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 108 - 199
Target Start/End: Original strand, 40940181 - 40940270
Alignment:
Q  108 atggttcgatcaataaatcatagcagggctgtaattttgcgcttttatcggttttcagtgcatgtgcaattttgtttgatatctatccctca 199  Q
    ||||||| |||||||||||||||| ||||||| |||||||||||||||| |||||   || ||||||| ||||| ||||| |||||||||||    
T  40940181 atggttcaatcaataaatcatagcggggctgtcattttgcgcttttatcagtttttgatg-atgtgcacttttg-ttgatttctatccctca 40940270  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University