View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17166_low_87 (Length: 269)

Name: NF17166_low_87
Description: NF17166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17166_low_87
NF17166_low_87
[»] chr3 (2 HSPs)
chr3 (143-239)||(11666343-11666439)
chr3 (198-239)||(1710975-1711016)


Alignment Details
Target: chr3 (Bit Score: 69; Significance: 5e-31; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 143 - 239
Target Start/End: Complemental strand, 11666439 - 11666343
Alignment:
Q  143 agaatttctagaacattttttgtgtttttatgaacgtgtgataaatannnnnnnnaagaaatcaaaatgatattaataacctcaggactatcttcat 239  Q
    |||||||||||||||||||||||||||||||||||||||||||||||        ||||||| ||||||||||||||||||||||||||||||||||    
T  11666439 agaatttctagaacattttttgtgtttttatgaacgtgtgataaatattttttttaagaaattaaaatgatattaataacctcaggactatcttcat 11666343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 198 - 239
Target Start/End: Complemental strand, 1711016 - 1710975
Alignment:
Q  198 aagaaatcaaaatgatattaataacctcaggactatcttcat 239  Q
    |||||||||||||||||||| ||||| || ||||||||||||    
T  1711016 aagaaatcaaaatgatattattaaccacaagactatcttcat 1710975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University